پیشگیری لیشمانیا

%PDF-1.3
3 0 obj
>>>]
/Contents 4 0 R>>
endobj
4 0 obj
>
stream
xUO
0+樇IH(UQ|BcբkSXPzΈ#bSp.gcr⚪_JN^G/fŲɸxyצ

WHO

M. Saeedi

پیشگیری لیشمانیا

Leishmaniasis is caused by a protozoa parasite from over 20 Leishmania species. Over 90 sandfly species are known to transmit Leishmania parasites. There are 3 main forms of the disease:

Leishmania parasites are transmitted through the bites of infected female phlebotomine sandflies, which feed on blood to produce eggs. The epidemiology of leishmaniasis depends on the characteristics of the parasite and sandfly species, the local ecological characteristics of the transmission sites, current and past exposure of the human population to the parasite, and human behaviour. Some 70 animal species, including humans, have been found as natural reservoir hosts of Leishmania parasites.

Visceral, cutaneous or mucocutaneous leishmaniasis are endemic in Algeria and countries in East Africa which are highly endemic. In East Africa, outbreaks of visceral leishmaniasis occur frequently.

The epidemiology of cutaneous leishmaniasis in the Americas is very complex, with variations in transmission cycles, reservoir hosts, sandfly vectors, clinical manifestations and response to therapy, and multiple circulating Leishmania species in the same geographical area. Brazil represents over 90% of the VL cases in that region.

This region accounts for 70% of the cutaneous leishmaniasis cases worldwide. Visceral leishmaniasis is highly endemic in Iraq, Somalia and Sudan.

Cutaneous and visceral leishmaniasis are endemic in this region. There are also imported cases mainly from Africa and the Americas.

Visceral leishmaniasis is the main form of the disease in this region, also endemic for cutaneous leishmaniasis. The region is the only one with a regional initiative to eliminate visceral leishmaniasis as a public health problem by 2020.

Post-kala-azar dermal leishmaniasis (PKDL) is usually a sequel of visceral leishmaniasis that appears as macular, papular or nodular rash usually on face, upper arms, trunks and other parts of the body. It occurs mainly in East Africa and on the Indian subcontinent, where 5–10% of patients with kala-azar are reported to develop the condition. It usually appears 6 months to 1 or more years after kala-azar has apparently been cured, but can occur earlier. People with PKDL are considered to be a potential source of Leishmania infection.

Leishmania-HIV coinfected people have high chance of developing the full-blown clinical disease, and high relapse and mortality rates. Antiretroviral treatment reduces the development of the disease, delays relapses and increases the survival of the coinfected patients. High Leishmania-HIV coinfection rates are reported from Brazil, Ethiopia and the state of Bihar in India.

Poverty increases the risk for leishmaniasis. Poor housing and domestic sanitary conditions (such as a lack of waste management or open sewerage) may increase sandfly breeding and resting sites, as well as their access to humans. Sandflies are attracted to crowded housing as these provide a good source of blood-meals. Human behaviour, such as sleeping outside or on the ground, may increase risk.

Diets lacking protein-energy, iron, vitamin A and zinc increase the risk that an infection will progress to a full-blown disease.

Epidemics of both cutaneous and visceral leishmaniasis are often associated with migration and the movement of non-immune people into areas with existing transmission cycles. Occupational exposure as well as widespread deforestation remain important factors.

The incidence of leishmaniasis can be affected by changes in urbanization, and the human incursion into forested areas.

Leishmaniasis is climate-sensitive as it affects the epidemiology in a number of ways:

In visceral leishmaniasis, diagnosis is made by combining clinical signs with parasitological, or serological tests (such as rapid diagnostic tests). In cutaneous and mucocutaneous leishmaniasis serological tests have limited value and clinical manifestation with parasitological tests confirms the diagnosis.

The treatment of leishmaniasis depends on several factors including type of disease, concomitant pathologies, parasite species and geographic location. Leishmaniasis is a treatable and curable disease, which requires an immunocompetent system because medicines will not get rid of the parasite from the body, thus the risk of relapse if immunosuppression occurs. All patients diagnosed as with visceral leishmaniasis require prompt and complete treatment. Detailed information on treatment of the various forms of the disease by geographic location is available in the WHO technical report series 949, “Control of leishmaniasis”.

Prevention and control of leishmaniasis requires a combination of intervention strategies because transmission occurs in a complex biological system involving the human or animal reservoir host, parasite and sandfly vector. Key strategies for prevention are listed below:

WHO’s work on leishmaniasis control involves:

Han S(1), Wu WP(2), Chen K(1), Osman I(3), Kiyim K(4), Zhao J(3), Hou YY(3), Wang
Y(1), Wang LY(1), Zheng CJ(5).

Author information:
(1)National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, WHO Collaborating Center for Tropical Diseases, Key Laboratory of Parasite and Vector Biology, Ministry of Health, National Center for International Research on Tropical Diseases, Ministry of Science and Technology, Shanghai, 200025, China.

(2)National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, WHO Collaborating Center for Tropical Diseases, Key Laboratory of Parasite and Vector Biology, Ministry of Health, National Center for International Research on Tropical Diseases, Ministry of Science and Technology, Shanghai, 200025, China. wu_wpipd@163.com.

(3)Xinjiang Uygur Autonomous Regional Center for Disease Control and Prevention, Urumqi, China.

(4)Kashgar Prefectural Center for Disease Control and Prevention, Kashgar, China.

(5)Chinese Center for Disease Control and Prevention, Beijing, China.

BACKGROUND: Leishmania parasites cause visceral leishmaniasis (VL), an important
infectious disease that is endemic to large parts of the world and often leads to
epidemics. Sand flies are the primary transmission vector for the parasite in
endemic regions. We hypothesized that sheep might serve as an overlooked
reservoir for Leishmania transmission to humans due to the asymptomatic nature of
infection in many species. As a preliminary test of this hypothesis, the aim of
the present study was to investigate sheep in an area of China that is endemic
for the desert sub-type of zoonotic VL and establish if they are potential
carriers of Leishmania.
RESULTS: Sheep tissue samples were collected from abattoirs in VL endemic areas
of Jiashi County, China during the non-transmission season. rK39
immunochromatographic tests were performed to detect the presence of the parasite
in blood samples. In addition, DNA was extracted from the blood, and used for
detection of the Leishmania-specific internal transcribed spacer-1 (ITS-1)
genomic region using a nested polymerase chain reaction (PCR) approach. PCR
products were further analyzed to identify restriction fragment-length
polymorphism patterns and representative sequences of each pattern were selected
for phylogenetic analysis. The rK-39 and nested PCR data indicated positive
detection rates for Leishmania in sheep of 26.32 and 54.39%, respectively. The
phylogenetic analysis revealed that all of the samples belonged to the species L.
infantum and were closely related to strains isolated from human infections in
the same area.
CONCLUSIONS: Sheep could be a potential host for Leishmania in VL endemic areas
in China and may be an overlooked reservoir of human VL transmission in this
region. To further confirm livestock as a potential host, further verification is
required using a sand fly biting experiment.

پیشگیری لیشمانیا

PMCID: PMC6276147

Bekhit AA(1), El-Agroudy E(2), Helmy A(3), Ibrahim TM(4), Shavandi A(5), Bekhit
AEA(6).

Author information:
(1)Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Alexandria University, Alexandria, 21521, Egypt; Pharmacy Program, Allied Health Department, College of Health Sciences, University of Bahrain, P.O. Box 32038, Bahrain. Electronic address: adnbekhit@pharmacy.alexu.edu.eg.

(2)Department of Pharmaceutical Chemistry, Faculty of Pharmacy, Alexandria University, Alexandria, 21521, Egypt.

(3)Faculty of Pharmacy, Alexandria University, Alexandria, 21521, Egypt.

(4)Pharmaceutical Chemistry Department, Faculty of Pharmacy, Kafrelsheikh University, Kafr El-Sheikh, 33516, Egypt.

(5)Centre for Materials Science and Technology, University of Otago, Dunedin, New Zealand; Interfaculty School of Bioengineers, Université Libre de Bruxelles, Brussels, Belgium.

(6)Department of Food Science, University of Otago, Dunedin, New Zealand.

Leishmaniasis affects over 150 million people all over the world, especially in
subtropical regions. Currently used antileishmanial synthesized drugs are
associated with some drawbacks such as resistance and cytotoxicity, which hamper
the chances of treatment. Furthermore, effective leishmanial vaccines are not
well developed. Promising chemotherapy, either from natural or synthetic
compounds, was or still is the most promising treatment. This review focuses on
recent findings in drugs used for the treatment of leishmaniasis including;
chemical and natural antileishmanial moieties, different potential targets, as
well as various trials of vaccination development. Special emphasis has been paid
to the mechanisms of the drugs, their safety and where possible, the
structure-activity relationship to enable guided future drug discovery.

پیشگیری لیشمانیا

aCenters for Disease Control and Prevention, Division of Parasitic Diseases and Malaria, Center for Global Health, Atlanta, Georgia, USA

bGulhane Military Medicine Academy, Department of Microbiology, Ankara, Turkey

aCenters for Disease Control and Prevention, Division of Parasitic Diseases and Malaria, Center for Global Health, Atlanta, Georgia, USA

aCenters for Disease Control and Prevention, Division of Parasitic Diseases and Malaria, Center for Global Health, Atlanta, Georgia, USAپیشگیری لیشمانیا

aCenters for Disease Control and Prevention, Division of Parasitic Diseases and Malaria, Center for Global Health, Atlanta, Georgia, USA

Leishmaniasis in humans is caused by Leishmania spp. in the subgenera Leishmania and Viannia. Species identification often has clinical relevance. Until recently, our laboratory relied on conventional PCR amplification of the internal transcribed spacer 2 (ITS2) region (ITS2-PCR) followed by sequencing analysis of the PCR product to differentiate Leishmania spp. Here we describe a novel real-time quantitative PCR (qPCR) approach based on the SYBR green technology (LSG-qPCR), which uses genus-specific primers that target the ITS1 region and amplify DNA from at least 10 Leishmania spp., followed by analysis of the melting temperature (Tm) of the amplicons on qPCR platforms (the Mx3000P qPCR system [Stratagene-Agilent] and the 7500 real-time PCR system [ABI Life Technologies]). We initially evaluated the assay by testing reference Leishmania isolates and comparing the results with those from the conventional ITS2-PCR approach. Then we compared the results from the real-time and conventional molecular approaches for clinical specimens from 1,051 patients submitted to the reference laboratory of the Centers for Disease Control and Prevention for Leishmania diagnostic testing. Specimens from 477 patients tested positive for Leishmania spp. with the LSG-qPCR assay, specimens from 465 of these 477 patients also tested positive with the conventional ITS2-PCR approach, and specimens from 10 of these 465 patients had positive results because of retesting prompted by LSG-qPCR positivity. On the basis of the Tm values of the LSG-qPCR amplicons from reference and clinical specimens, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate; the Leishmania (Leishmania) donovani complex in aggregate; the species L. (L.) tropica; and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica in aggregate.

Leishmaniasis is endemic in the tropics, subtropics, and southern Europe and encompasses diverse clinical syndromes, including cutaneous, mucosal, and potentially life-threatening visceral forms (1,–4). Overall, leishmaniasis in humans is caused by ∼20 Leishmania spp. in the subgenera Viannia and Leishmania; >1 species may be found in the same geographic region. Species identification often has clinical relevance, such as implications regarding whether and which treatment is indicated and whether and how to monitor for potential sequelae of the infection (e.g., mucosal leishmaniasis, which is typically caused by New World species in the Viannia subgenus, particularly, but not only, by Leishmania [Viannia] braziliensis in certain geographic regions) (1, 3,–7).

In the U.S. civilian sector, the reference laboratory of the Centers for Disease Control and Prevention (CDC) provides diagnostic identification of Leishmania spp. in human clinical specimens using parasitologic and molecular techniques. In contrast to the traditional parasitologic approach for Leishmania species identification (in vitro culture of parasites followed by isoenzyme analysis [multilocus enzyme electrophoresis]), molecular approaches are typically more sensitive, less labor-intensive, and more rapid (i.e., they provide results within days rather than weeks or months) (4, 8,–11). The sensitivity, specificity, and utility of DNA-based methods for genus-, subgenus/complex-, and species-level characterization of Leishmania parasites have been discussed extensively (10,–16).

Until recently, CDC’s molecular algorithm for the diagnosis of leishmaniasis relied on a conventional PCR method that amplifies the rRNA internal transcribed spacer 2 (ITS2) region (ITS2-PCR), followed by DNA sequencing analysis of the amplicons to identify the species (17). The advantages of real-time quantitative PCR (qPCR) approaches in comparison with conventional PCR assays include the potential for increased sensitivity and specificity and for a decreased risk of contamination of the laboratory environment (14, 18,–26). The efficiency of real-time platforms for Leishmania species identification has been discussed (24, 27,–30). Although real-time PCR approaches have the potential for identifying different Leishmania spp. simultaneously, many of the described qPCR methods detect only some of the pertinent Leishmania spp. or strains (24, 27, 28, 30). Although assays that target minicircle kinetoplast DNA (kDNA) are the most sensitive PCR methods for detecting Leishmania parasites because of the abundance of minicircles in each kinetoplast (13, 29, 31, 32), the high-level sequence polymorphism among minicircles is a substantial limitation for systematic species identification solely on the basis of this marker.

The advantages of real-time PCR approaches and our observation of occasional ITS2-PCR-negative but culture-positive results in the CDC reference laboratory prompted us to develop a qPCR assay for the molecular diagnosis of Leishmania infection. We selected the ITS1 region as the target because of the high estimated number of copies of the rRNA gene (range, 40 to 200) per Leishmania species genome. Comparisons of the DNA sequences of the ITS1 region of some Leishmania spp. have shown interspecies variations and single nucleotide polymorphisms that have been useful for species identification and molecular typing (12, 17, 33, 34).

Here we describe our development and evaluation of a novel qPCR approach, based on the SYBR green technology (LSG-qPCR), which uses a genus-specific pair of primers that span the rRNA ITS1 region, followed by analysis of the melting temperature (Tm) of the amplicons on qPCR platforms. By using this methodology, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate (L. [V.] braziliensis, L. [V.] guyanensis, and L. [V.] panamensis) (group 1 [G1]); the L. (L.) donovani species complex in aggregate (L. [V.] donovani and L. [L.] infantum/L. [L.] chagasi) (group 2A [G2A]); the species L. (L.) tropica (group 2B [G2B]); and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica in aggregate (group 3 [G3]). Our results indicate that this method can serve as an efficient tool for presumptive species identification.

In our initial evaluations of the LSG-qPCR assay (in comparison with the ITS2-PCR approach), Leishmania DNA was amplified from all of the WHO reference markers and CDC cultured isolates. (See below for information regarding Tm analysis and species discrimination.) In further evaluations, among the specimens from 1,051 patients (1 specimen per patient) submitted to the CDC reference laboratory for Leishmania diagnostic testing, 477 specimens tested positive for Leishmania spp. with the LSG-qPCR assay, and 465 of these (i.e., 12 fewer specimens) also tested positive with the conventional ITS2-PCR assay. Specimens from a total of 574 patients tested negative with both assays.

The specimens from 477 patients that tested positive with the LSG-qPCR assay included 22 specimens with high cycle threshold (CT) values (CT values ≥ 36)—15 of which were extracts from paraffin-embedded tissue blocks or hematoxylin and eosin (H the positive ITS2-PCR results were obtained when diluted DNA aliquots were tested (5 patients) or when a new DNA extract was tested (2 patients). The specimens for the other 3 (of 10) patients were fresh tissue, and the positive ITS2-PCR results were obtained when aliquots of new DNA extracts from fresh tissue were tested. Species identification was not accomplished for the other 12 (of 22) patients because the ITS2-PCR results were negative (8 patients) or the amplicon concentration was too low to proceed with sequencing analysis (4 patients) even after retesting; six paraffin-embedded tissue blocks and two slide extracts had A260/A280 ratios consistent with poor-quality DNA.

The 220- to 275-bp-long fragments amplified by LSG-qPCR (Fig. 1) from reference DNA (WHO and CDC isolates) and clinical specimens were subjected to Tm analyses. On the basis of the amplicons’ Tm values observed with the Stratagene Mx3000P and ABI 7500 platforms, Leishmania spp. (as identified by conventional ITS2-PCR followed by DNA sequencing analysis) were classified into four groups, referred to here as G1, G2A, G2B, and G3 (Fig. 2A and andB).B). The agreement regarding the presumptive species (or subgenus/complex) identification—i.e., the Viannia subgenus in aggregate (G1); the L. (L.) donovani complex in aggregate (G2A); the species L. (L.) tropica (G2B); and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica in aggregate (G3)—was 100%. The median Tm values for the various Tm groups on the two platforms are provided in Tables 1 and and2.2. For each group, the median Tm value was ∼1.5°C higher on the Stratagene Mx3000P platform than on the ABI 7500 platform.

For reference sizes, amplicons from the LSG-qPCR and QC-qPCR were resolved on a 1.5% agarose gel. Lanes 1 and 5, 100-bp ladder size standards; lane 2, L. (V.) panamensis; lane 3, L. (L.) tropica (G2B); lane 4, L. (L.) aethiopica; lane 6, human beta-actin QC-qPCR fragment.

(A) SYBR green dissociation curve analyses of LSG-qPCR amplicons from the Stratagene Mx3000P platform. G1, L. (V.) braziliensis, L. (V.) guyanensis, and L. (V.) panamensis; G2A/B, L. (L.) infantum/L. (L.) chagasi and L. (L.) tropica; G3, L. (L.) amazonensis, L. (L.) mexicana, L. (L.) aethiopica, and L. (L.) major. (B) SYBR green dissociation curve analyses of LSG-qPCR amplicons from the ABI 7500 platform. *, L. (V.) braziliensis and L. (V.) panamensis (G1); **, L. (L.) infantum/L. (L.) chagasi and L. (L.) tropica (G2A/B); ***, L. (L.) mexicana and L. (L.) major (G3). QC, human beta-actin amplicons from quality control reactions. The melting temperature is the highest point of each curve.

Leishmania test results for patient specimensa analyzed by LSG-qPCR with the Stratagene Mx3000P platform

Leishmania test results for patient specimensa analyzed by LSG-qPCR with the ABI 7500 platform

Of the 603 patient specimens tested by use of the Stratagene Mx3000P platform, 279 had positive results and were classified by Tm group (Table 1). By comparison of the Tm values of the LSG-qPCR amplicons, the following Tm ranges were established for each group (some of which overlap): 78.4 to 79.5°C for G1, 79.5 to 80.2°C for G2A, 80.2 to 80.8°C for G2B, and 81.1 to 82.9°C for G3 (Table 1). By using the results of ITS2 sequencing analyses, the etiologic agents of the 142 cases of infection with Viannia spp. (G1) were identified to be L. (V.) braziliensis (n = 40 cases), L. (V.) guyanensis (n = 4), and L. (V.) panamensis (n = 98). In G2A, 40 cases of infection caused by species in the L. (L.) donovani complex were identified; in G2B, 20 cases of L. (L.) tropica infection were identified; and in G3, 27 cases of infection with L. (L.) mexicana, 2 cases of infection with L. (L.) amazonensis, 36 cases of infection with L. (L.) major, and 4 cases of infection with L. (L.) aethiopica were identified (Table 1).

Two specimens had a Tm value of 79.5°C, consistent with either G1 or G2A; one of the two was associated with a case of L. (V.) braziliensis infection (G1), and the other was associated with a case of infection caused by the L. (L.) donovani complex (G2A). Seven specimens had a Tm value of 80.2°C, consistent with either G2A or G2B; two of the seven were associated with cases of infection caused by the L. (L.) donovani complex (G2A), and five were associated with L. (L.) tropica infection (G2B). These overlapping Tm values for nine specimens were not resolved (i.e., the Tm values did not change and remained consistent with >1 group) after the testing and analyses were redone twice with different DNA extraction aliquots.

The 279 positive specimens identified by use of the Stratagene Mx3000P platform included 8 of the 12 for which the ITS2-PCR approach did not succeed in identifying the Leishmania species. The Tm values and, consequently, the Tm groups for these amplicons were supported by the patients’ travel histories (data not shown); e.g., a specimen from a patient who had traveled to Costa Rica had a Tm value of 78.9°C (G1; consistent with the Viannia subgenus), and a specimen from a patient who had traveled to Israel had a Tm value of 82.3°C (consistent with G3). Figure 2A shows the dissociation curves obtained with the Stratagene Mx3000P platform in single peaks, which represent the results of Tm analyses.

Of the 448 patient specimens tested by use of the ABI 7500 platform, 198 had positive results and were classified by Tm group (Table 2). By comparison of the Tm values of the LSG-qPCR amplicons, the following Tm ranges were established for each group (some of which overlap): 76.8 to 77.9°C for G1, 78.0 to 79.0°C for G2A, 79.0 to 79.5°C for G2B, and 80.0 to 80.8°C for G3 (Table 2). By using the results of ITS2 sequencing analyses, the etiologic agents of the 88 cases of infection with Viannia spp. (G1) were identified to be L. (V.) braziliensis (n = 36 cases), L. (V.) guyanensis (n = 4), and L. (V.) panamensis (n = 48). In G2A, 28 cases of infection caused by species in the L. (L.) donovani complex were identified; in G2B, 17 cases of L. (L.) tropica infection were identified; and in G3, 28 cases of infection with L. (L.) mexicana, 2 cases of infection with L. (L.) amazonensis, 30 cases of infection with L. (L.) major, and 1 case of infection with L. (L.) aethiopica were identified (Table 2). Five specimens had a Tm value of 79.0°C, which can indicate either G2A or G2B; one of the five specimens was associated with an infection caused by the L. (L.) donovani complex (G2A), and four were associated with L. (L.) tropica infection (G2B).

The 198 positive specimens identified by using the ABI 7500 platform included 4 of the 12 specimens for which the ITS2-PCR approach did not succeed in identifying the Leishmania species. The Tm values and groups for these cases were also supported by the patients’ travel histories (data not shown); e.g., a specimen from a patient who had traveled to Ecuador had a Tm value of 77.4°C (G1; consistent with the Viannia subgenus), and a specimen from a patient who had traveled to Israel had a Tm value of 80.6°C (consistent with G3). Figure 2B shows the dissociation curves obtained with the ABI 7500 platform in single peaks, which represent the results of Tm analyses.

Amplification of a beta-actin fragment (Fig. 1) was used to monitor the quality of the extracted DNA, to avoid having false-negative results because of poor DNA quality and/or PCR inhibitors. The quality control (QC) qPCR effectively amplified DNA from all of the clinical specimens that we tested, with the Tm values ranging from 85.3 to 86.8°C and from 84.6 to 85.8°C on the Stratagene Mx3000P and ABI 7500 platforms, respectively; i.e., the Tm values were higher than those for the Leishmania spp. (Fig. 2A and andB).B). For most specimens, the CT values were in the range of 20 to 25; however, we noticed that CT values were ≥36 if DNA had been extracted from slides or paraffin blocks that had low parasite concentrations and/or poor A260/A280 ratios (data not shown).

When we prepared LSG-qPCR mixtures using DNA from other protozoa (e.g., Trypanosoma, Plasmodium, and Entamoeba spp.), we did not detect any amplified products (data not shown).

Our evaluations of the LSG-qPCR method demonstrated that it was highly efficient in differentiating at least 10 Leishmania spp. into four Tm groups that we referred to as G1, G2A, G2B, and G3. We selected the primers LSGITS1-F1 and LSGITS1-R1 because they could amplify DNA from multiple Leishmania spp. and yield amplicons separable into Tm groups and thereby could provide an additional level of confidence regarding the results obtained by the complementary ITS2-PCR approach that we used to identify the particular Leishmania sp. in a clinical specimen. When we tested clinical specimens from 1,051 patients on either of two platforms—the Stratagene Mx3000p or the ABI 7500 platform—the results were encouraging with both platforms. On the basis of the aggregate LSG-qPCR results for both platforms, we identified 477 Leishmania-positive cases, 465 of which (i.e., 12 fewer cases) were confirmed by the ITS2-PCR assay. The presumptive species (or subgenus/complex) identifications based on the LSG-qPCR amplicons’ Tm values (and the Tm groups) were concordant with the ITS2-PCR species identifications—i.e., the Viannia subgenus (G1); the L. (L.) donovani complex (G2A); the species L. (L.) tropica (G2B); and the species L. (L.) mexicana, L. (L.) amazonensis, L. (L.) major, and L. (L.) aethiopica (G3)—with the exceptions involving issues associated with overlapping Tm values and specimens that tested positive by only one approach.

In this investigation, use of the LSG-qPCR assay facilitated the diagnosis of leishmaniasis in 22 patients whose specimens had negative or equivocal results by ITS2-PCR but positive results by LSG-qPCR with CT values of ≥36. It was not surprising that some of the extracts from paraffin-embedded tissue blocks and H PCR inhibition and spurious results associated with DNA extracted from formalin-fixed specimens have been reported and resolved by other investigators (20, 35). Because of our presumptive positive results with the LSG-qPCR assay, a new specimen or a new aliquot of the first specimen was (re)tested by the ITS2-PCR, which otherwise would not have been performed. Because of this retesting prompted by the LSG-qPCR results, specimens from 10 of the 22 patients whose ITS2-PCR results were initially negative ended up testing positive by ITS2-PCR after all, such that DNA sequencing analysis could be performed and the Leishmania species could be definitively identified. For the 12 patients whose specimens tested positive only by LSG-qPCR and were not resolved by the ITS2-PCR approach even after retesting, the Tm group results were epidemiologically plausible in the context of the patients’ travel histories. However, the LSG-qPCR results alone did not suffice for final species identification.

We attribute the overlapping Tm values that we observed with both platforms to the variability in the intraspecies microsatellite repeats in the ITS1 region in the Leishmania genus. These intraspecies variations cannot be predicted. They apparently result from the low functional constraint over the ITS rRNA spacer regions compared with that over the functional parts of the gene, including 18S, 5.8S, and 28S rRNA (36, 37). We also observed that the median Tm values for the various Tm groups were ∼1.5°C higher when the Stratagene Mx3000P platform was used than when the ABI 7500 platform was used, even though the reagents and reaction protocol were the same for both platforms. However, regardless of which platform was used, all three species of the Viannia subgenus identified in this investigation by the ITS2-PCR approach—i.e., L. (V.) braziliensis, L. (V.) guyanensis, and L. (V.) panamensis, all three of which can be associated with mucosal leishmaniasis, although the risk varies by parasite and host factors—clustered together in G1. Both species in the L. (L.) donovani complex, which are the primary etiologic agents of visceral leishmaniasis and which can also cause cutaneous leishmaniasis, clustered together in G2A. G2B contained only L. (L.) tropica, an anthroponotic cause of cutaneous leishmaniasis in the Old World. Finally, zoonotic non-Viannia subgenus species that cause cutaneous leishmaniasis—L. (L.) mexicana and L. (L.) amazonensis (in the New World) and L. (L.) major and L. (L.) aethiopica (in the Old World)—clustered together in G3 (Tables 1 and and2).2). We do not yet have data regarding the Tm group classifications for Leishmania spp. that were not included in the investigation.

We used the human beta-actin QC reaction, which was designed to run side-by-side with the LSG-qPCR assay, as an independent reaction in a separate PCR tube. On both platforms, the Tm values for the QC amplicons were higher than those for the Leishmania spp.; therefore, the reactions could be analyzed simultaneously in the same run. We decided to use an endogenous (rather than an exogenous) internal control target for the particular diagnostic application that we described, to help confirm the structural integrity of the DNA extracted from paraffin-embedded tissue blocks and H two of the potential causes of PCR inhibition include DNA-protein cross-links and the fragmentation of nucleic acids (35).

In summary, the LSG-qPCR can amplify at least 10 Leishmania spp. that infect humans—including etiologic agents of cutaneous, mucosal, and visceral leishmaniasis—and allows rapid presumptive species identification, particularly if the Tm results are interpreted in the context of the patient’s residence and travel history. The fact that presumptive species identification can be accomplished by use of a single pair of primers, thereby minimizing the risk for contamination, not only is advantageous for reference diagnosis of leishmaniasis but also is a noteworthy difference from other molecular approaches described for the detection of Leishmania. We have incorporated the LSG-qPCR assay into CDC’s algorithm for the laboratory diagnosis of leishmaniasis. Whenever we obtain a positive LSG-qPCR result, we conduct conventional ITS2-PCR and sequencing analysis for definitive species identification.

For the ITS1-specific SYBR green PCR (LSG-qPCR) assay, we designed primers LSGITS1-F1 (CATTTTCCGATGATTACAC) and LSGITS1-R1 (CGTTATGTGAGCCGTTATC) on the basis of multiple alignments of the rRNA ITS1 region from the species L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) panamensis, L. (L.) mexicana, L. (L.) amazonensis, L. (L.) donovani, L. (L.) infantum/L. (L.) chagasi, L. (L.) major, L. (L.) tropica, and L. (L.) aethiopica; the primers amplify DNA fragments of ∼220 to 275 bp in length, depending on the species. During our initial evaluations of the LSG-qPCR approach, we compared the results of the LSG-qPCRs obtained on qPCR platforms (see below) with the results of the ITS2-PCR approach, i.e., ITS2-PCR followed by DNA sequencing analysis of the amplicons for final species identification (17). However, we used epidemiologic/geographic criteria to distinguish between L. (L.) donovani and L. (L.) infantum/L. (L.) chagasi (e.g., the latter but not the former is found in Latin America and southern Europe), which are not reliably distinguished by either of our molecular approaches.

For our initial evaluations of the LSG-qPCR procedure, we used DNA purified from the following WHO reference markers: L. (V.) braziliensis (MHOM/BR/75/M2903), L. (V.) guyanensis (MHOM/BR/75/M4147), L. (V.) panamensis (MHOM/PA/71/LS94), L. (L.) mexicana (MNYC/BZ/62/M379 and MHOM/BZ/82/BEL21), L. (L.) amazonensis (IFLA/BR/67/PH8 and MHOM/BR/73/M2269), L. (L.) donovani (MHOM/IN/80/DD8 and MHOM/ET/67/HU3), L. (L.) infantum (MHOM/TN/80/LEM235), L. (L.) chagasi (MHOM/BR/74/M2682), L. (L.) aethiopica (MHOM/ET/72/L100), L. (L.) major (MHOM/IL/67/JERICHO II and MHOM/SU/73/5-ASKH), and L. (L.) tropica (MHOM/SU/74/K27 and MHOM/SU/58/L39). We also included DNA from 22 cultured isolates (2 isolates of each species listed above) from CDC’s collection, identified by species using isoenzyme analysis and ITS2-PCR followed by sequencing analysis, as described elsewhere (17).

پیشگیری لیشمانیا

As a control reaction for the quality of the DNA extraction, all DNA extracts were tested by using a quality control (QC) qPCR (QC-qPCR) with primers BACTF (CGTGACATTAAGGAGAAGCTGTGC) and BACTR (CTCAGGAGGAGCAATGATCTTGAT), which amplify a 374-bp-long fragment of the human beta-actin gene. We adapted this QC reaction from a method described elsewhere (38) for use in a SYBR green assay format. The LSG-qPCR and QC-qPCR were separate reactions (in separate PCR tubes) in which the reaction mixtures were prepared by use of the same chemistry and cycling parameters.

The LSG-qPCR and QC-qPCR mixtures were prepared to a final volume of 20 μl by using 10 μl of 2× QuantiTect SYBR green PCR master mix (Qiagen), 10 μM each primer LSGITS1-F1/LSGITS1-R1 or BACTF/BACTR, ∼100 ng of genomic DNA template, and sterile water to adjust the reaction volume. A blank control reaction with sterile water instead of DNA (in addition to the negative DNA extraction control) was included in each PCR run. A positive control consisted of ∼10 ng of DNA extracted from Leishmania cultures. PCRs were run on either of two different qPCR platforms—the Stratagene Mx3000P qPCR system (Stratagene-Agilent) or the ABI 7500 real-time PCR system (ABI Life Technologies)—using the following cycling parameters: 95°C for 15 min and 40 cycles of 95°C for 15 s and 60°C for 1 min. Fluorescence data were collected at the end of each 60°C plateau. To differentiate among Leishmania spp., we analyzed the amplicons’ Tm values, using 1 cycle of 95°C for 1 min, 60°C for 30 s, and 95°C for 1 min. Fluorescence data were collected at the 60 to 95°C ramps.

The clinical specimens were tested in accordance with a CDC-approved protocol for the use of residual specimens from human subjects.

We are indebted to Richard Bradbury from the Centers for Disease Control and Prevention, Atlanta, GA, for invaluable assistance in reviewing the manuscript.

The findings and conclusions in this report are those of the authors and do not necessarily represent the official position of CDC.

National Center for
Biotechnology Information,
U.S. National Library of Medicine

8600 Rockville Pike, Bethesda
MD, 20894
USA

To receive email updates about this page, enter your email address:

For Health Care Providers, Emergency Consultations, and General Public.

Contact Us

Leishmaniasis is a parasitic disease that is found in parts of the tropics, subtropics, and southern Europe. It is classified as a neglected tropical disease (NTD). Leishmaniasis is caused by infection with Leishmania parasites, which are spread by the bite of phlebotomine sand flies. There are several different forms of leishmaniasis in people. The most common forms are cutaneous leishmaniasis, which causes skin sores, and visceral leishmaniasis, which affects several internal organs (usually spleen, liver, and bone marrow).پیشگیری لیشمانیا

Image: On average, the sand flies that transmit the parasite are only about one fourth the size of mosquitoes or even smaller. On the left, an example of a vector sand fly (Phlebotomus papatasi) is shown; its blood meal is visible in its distended transparent abdomen. On the right, Leishmania promastigotes from a culture are shown. The flagellated promastigote stage of the parasite is found in sand flies and in cultures. (Credit: PHIL, DPDx)

To receive email updates about this page, enter your email address:

For Health Care Providers, Emergency Consultations, and General Public.

Contact Us

Leishmaniasis is a tropical/sub-tropical disease caused by Leishmania protozoa, which is spread by the bite of infected sandflies.

There are several different forms of leishmaniasis in people. Cutaneous leishmaniasis causes skin sores which are often self-healing within a few months, but which may leave ugly scars; it occurs worldwide, including the Mediterranean coast. Visceral leishmaniasis causes systemic disease, presenting with fever, malaise, weight loss and anaemia, swelling of the spleen, liver and lymph nodes; most of the cases reported worldwide occur in Bangladesh, Brazil, India, Nepal and Sudan.

No vaccines or drugs to prevent infection are available. The best way for travellers to prevent infection is to protect themselves from sandfly bites.

Leishmaniasis (or ‘leishmaniosis’) is a group of tropical/sub-tropical infectious diseases of mammals caused by Leishmania protozoa. At least 20 species infect humans: Leishmania donovani and L. infantum cause acute visceral disease worldwide, excluding South-East Asia and Oceania; L. major and L. tropica cause most chronic cutaneous leishmaniasis in Europe, Asia and Africa, and chronic cutaneous and mucocutaneous leishmaniasis are caused by L. amazonensis, L. mexicana, L. braziliensis, L. guyanensis and L. peruviana in the Americas.

Most foci of fatal visceral leishmaniasis occur in India, neighbouring Bangladesh and Nepal, or Sudan and neighbouring Ethiopia and Kenya, where ‘Kala-azar’ is caused by L. donovani. In north-east Brazil and parts of Central America, ‘infantile visceral leishmaniasis’ is caused by L. infantum. The Mediterranean Basin and the adjoining Middle East are still endemic for visceral leishmaniasis caused by L. infantum, but ‘infantile visceral leishmaniasis’ is much less of a public health problem than it was up to the 1950s. This might be explained by a number of factors, including better nutrition, coincidental control of sandflies, and improved housing. However, the appearance of HIV/Leishmania co-infections illustrated the constant threat posed by having many asymptomatic carriers in southern Europe.پیشگیری لیشمانیا

There are only two transmission cycles endemic in Europe: visceral and cutaneous human leishmaniasis caused by Leishmania infantum throughout the Mediterranean region, and cutaneous human leishmaniasis caused by Leishmania tropica, which sporadically occurs in Greece and probably in neighbouring countries. Many human leishmaniasis cases in the EU are imported, after travel to tropical countries.

The incubation period varies from about 10 days to several months. Human leishmaniasis may manifest single or multiple skin lesions, often self-healing within a few months but leaving unsightly scars. Hosts develop acquired immunity through cellular and humoral responses, but infection can spread through the lymphatic and vascular system and produce more lesions in the skin (cutaneous, diffuse cutaneous leishmaniasis), the mucosa (mucocutaneous leishmaniasis) and invade the spleen, liver and bone marrow (visceral leishmaniasis). Common symptoms are fever, malaise, weight loss and anaemia, with swelling of the spleen, liver and lymph nodes in visceral human leishmaniasis.

Without treatment, most patients with the visceral disease will die and those with diffuse cutaneous and mucocutaneous disease can suffer long infections associated with secondary life-threatening infections. Treatment should be considered even for self-healing cutaneous leishmaniasis, because of the disfiguring scars.

Leishmaniasis is a mammalian disease. Zoonotic reservoir hosts include rodents (L. major, L. amazonensis, L. mexicana, L. braziliensis), marsupials (L. amazonensis, L. mexicana, L. braziliensis), edentates and monkeys (L. braziliensis), and canids (L. infantum).
The domestic dog is the only reservoir host of major veterinary importance.

Transmission is usually by bite of haematophagous females of some sandfly species of the genera Phlebotomus (Europe, Asia and Africa) and Lutzomyia (Americas). The female sandfly ingests Leishmania amastigotes when she takes a blood meal and, if of a permissive species, transmits the infective metacyclic stages at a subsequent blood meal.

L. infantum can be transmitted from mother to child, female dog to puppy and by shared syringes.

There are no specific risk groups for leishmania infections.

While there is a high risk of cutaneous leishmaniasis caused by L. tropica emerging in southern Europe as a result of the abundance of vectors, the risk is lower for visceral leishmaniasis caused by L. donovani because vectors are absent. Prevention of emergence depends on efficient surveillance and prompt treatment of all human leishmaniasis infections.
To reduce bites of peridomestic vectors, insecticide-treated nets and topically applied insecticides can be used. Dog collars impregnated with deltamethrin are used to control the infection of reservoir dogs.

The diagnosis of leishmaniasis is mainly based on symptoms, the microscopic identification of the parasites in Giemsa-stained smears of tissue or fluid (from lesions, bone marrow, spleen), and serology.

Pentavalent antimonials were for a long time the first-choice drugs for leishmaniasis, and remain so in many endemic tropical countries, partly because of the production of generic drugs. In some regions, mainly where resistance has developed, miltefosine, paramycin and liposomal amphotericin B are gradually replacing the antimonials.
The aim is to develop combination therapy to prevent the emergence of resistance to new drugs.

The significance of alternative modes of transmission like syringe sharing or mother-to-child transmission needs further investigation, especially for assessing the potential emergence of leishmaniasis in northern Europe. The availability of an effective vaccine for human leishmaniasis would allow an immunisation strategy for rural Mediterranean populations. Finally, better predictive modelling of disease transmission is needed.

Alvar J, Canavate C, Gutierrez-Solar B, Jimenez B, Laguna F, Lopez Velez R et al. Leishmania and human immunodeficiency virus co-infection: the first 10 years. Clin Microbiol Rev1997;10:298-319.

Ameen M. Cutaneous leishmaniasis: therapeutic strategies and future directions. Expert Opin Pharmacother 2007;8:2689-2699.

Boelaert M, El-Safi S, Hailu A, Mukhtar M, Rijal S, Sundar S et al. Diagnostic tests for kala-azar: a multi-centre study of the freeze-dried DAT, rK39 strip test and KAtex in East Africa and the Indian subcontinent. Trans R Soc Trop Med Hyg 2008;102:32-40.

Croft SL, Sundar S, Fairlamb AH. Drug resistance in leishmaniasis. Clin Microbiol Rev 2006;19:111-126.

Cruz I, Morales MA, Noguer I, Rodriquez A, Alvar J. Leishmania in discarded syringes from intravenous drug users (IVDUs). Lancet 2002;359:1124-1125.

Desjeux P. Leishmaniasis: current situation and new perspectives. Comp Immunol Microbiol Dis 2004;27:305-318.

Dujardin JC et al. Spread of vector-borne diseases and neglect of leishmaniasis, Europe. Emerging Infect Dis 2008;14:1013-1018.

Killick-Kendrick R. Phlebotomine vectors of the leishmaniases: a review. Med Vet Entomol 1990;4:1-24.

Ready PD. Leishmaniasis emergence and climate change. In: S de la Roque, editor. Climate change: the impact on the epidemiology and control of animal diseases. Rev Sci Tech Off Int Epiz 2008;27 (2): in press.

Reithinger R, Teodoro U, Davies CR. Topical insecticide treatments to protect dogs from sand fly vectors of leishmaniasis. Emerg Infect Dis 2001;7:872-876.

World Health Organization/TDR. Leishmaniasis [online] 2001 [cited 2008 June 10]. Available from: URL:https://www.who.int/tdr/diseases/leish/diseaseinfo.htm

Intranet |

01 JAN

پیشگیری لیشمانیا

01 JAN

Leishmaniosis prevention and control should include novel communication strategies that must be easily accesible and would include new advances in the knowledge of the disease. Recently, other animals different than dogs have been described as competent reservoirs of Leishmania, playing an important epidemiological role in recent outbreaks in Europe and Asia. At the moment, most of the information available is fundamentally devoted to humans and dogs, and there is no a global approach to the disease, taking into account all possible reservoirs.

Stopleishmania.org is an initiative of the VISAVET Health Surveillance Centre (UCM), the National Centre of Microbiology (ISCIII), the Animal Protection Centre (Madrid City Council) and the Directorate of Public Health (Regional Government of Madrid). This project launches the possibility of collaboration with other research centres, feeding the site with updated information on this disease.

Leishmaniosis in humans

Leishmaniosis are vector-borne diseases caused by obligate protistan parasites from the genus Leishmania. These parasites are transmitted to vertebrates and frequently hosted by canids and rodents; therefore the disease may be zoonoses, anthropozoonoses or anthroponoseses, although few species are strictly anthroponotic. In the Mediterranean basin the dog is considered as the main reservoir maintaining a peridomestic enzootia, with potential transmission to susceptible human populations. Recently, Leporidae (hares and rabbits) have been described as competent reservoirs of Leishmania, involved in the largest outbreak described in Europe until date.

More information about leishmaniosis in humans…

Leishmaniosis vector

These parasites are transmitted to vertebrates by the bite of infected female phlebotomine sandflies. Some 80 species and subspecies of phlebotomine sandflies have been described, and leishmania is transmitted by about 30. The genus Phlebotomus in the Old World, and Lutzomyia in the New World, are the proven transmitters of leishmaniasis.

More information about leishmaniosis vector…

Leishmaniosis in other animals

More information about leishmaniosis in other animals…

Leishmaniosis in dogs

More information about leishmaniosis in dogs…

Leishmaniosis no transmission

The parasite is mainly transmitted to human and animals through the bites of infected female phlebotomine sandflies. Leishmaniosis is not considered a food-borne zoonosis, so there is no risk in the consumption of animal carriers. There is also no contagion from direct contact with an infected animal. However, atypical transmission routes of have been described, including blood transfusion, sexual contact, needle sharing and also mother-to-child transmission.

More information about leishmaniosis transmission…

Leihsmaniosis transmission

More information about leishmaniosis risks factors…

Leishmaniosis control and prevention in humans

Prevention and control of leishmaniosis requires a combination of intervention strategies because transmission occurs in a complex biological system involving the human host, parasite, sandfly vector and in some causes an animal reservoir host. Key strategies for prevention are listed below:

WHO

WHO

WHO

WHO

M. Saeedi

WHO’s work on leishmaniasis control involves:

Related

PMCID: PMC6276147

bGulhane Military Medicine Academy, Department of Microbiology, Ankara, Turkey

To receive email updates about this page, enter your email address:

For Health Care Providers, Emergency Consultations, and General Public.

Contact Us

To receive email updates about this page, enter your email address:

For Health Care Providers, Emergency Consultations, and General Public.

Contact Us

There are no specific risk groups for leishmania infections.

Intranet |

01 JAN

01 JAN

01 JAN

01 JAN

01 JAN

Leishmaniosis in humans

More information about leishmaniosis in humans…

Leishmaniosis vector

More information about leishmaniosis vector…

Leishmaniosis in other animals

More information about leishmaniosis in other animals…

Leishmaniosis in dogs

More information about leishmaniosis in dogs…

Leishmaniosis no transmission

More information about leishmaniosis transmission…

Leihsmaniosis transmission

More information about leishmaniosis risks factors…

Leishmaniosis control and prevention in humans

More information about leishmaniosis control and prevention…

Leishmaniosis control and prevention in other animals

More information about leishmaniosis control and prevention…

Leishmaniosis control and prevention in dogs

More information about leishmaniosis control and prevention…

نوشته‌های مرتبط

عوارض قرص های ضد جوش دکتر مورد

قرص هاي ضد جوش دكتر مورد

عوارض قرص ضد جوش دکتر مورد

دیدگاهتان را بنویسید لغو پاسخ